5. biosintesis protein biokim inw

8/13/2019 5. Biosintesis Protein Biokim Inw

1/29

Biosintesis ProteinMK. Biokimia

Universitas Udayana

I Nengah WirajanaEmail: [email protected]


2/29

Pendahuluan

Anda telah mengetahui bagaimana DNAdireplikasi dan bagaimana DNA ditranskripsi

menjadi RNA.

Kita sekarang akan mempelajari mekanisme

sintesis protein, suatu proses yang disebut

translasikarena empat-hurup alfabet asam

nukleat (GACT) ditranslit menjadi dua puluh

hurup alfabet protein (20 asam amino). Translasi terjadi dalam ribosom.

1/1/2014 2


3/29

Pendahuluan

Protein Assembly. The ribosome, shown at the right, is a factory for the manufacture of

polypeptides. Amino acids are carried into the ribosome, one at a time, connected to transfer RNA

molecules (blue). Each amino acid is joined to the growing polypeptide chain, which detaches

from the ribosome only once it is completed. This assembly line approach allows even very long

polypeptide chains to be assembled rapidly and with impressive accuracy. [(Left) Doug

Martin/Photo Researchers.]Sumber : 1/1/2014 3


4/29

Kodon

1/1/2014 4


5/29

Kodon = triplet pengkode asam amino

Woblefenomena pembentukan

pasangan basa komplementer antara

kodon dalam mRNA denganantikodonnya dalam tRNA pada

posisi ketiga dalam triplet biasanya

tidak terlalu terbatas seperti halnyapada dua posisi pertama.

1/1/2014 5


6/29


7/29

Codon Reading Frame

AUG is always thestart codon so allpolypeptides beginwith Methionine

when they aresynthesized

Having a consistentstart codon is

necessary so thatthe reading frameis always the same.

1/1/2014 7


8/29

1. Translasi Urutan Nukleotida

Menjadi Urutan asam Amino Dasar sintesis protein sama pada

semua mahluk hidup (all kingdoms of

life), menunjukkan fakta bahwa sistem

sintesis protein muncul paling awaldalam evolusi.

Protein disintesis dalam arah dari

amino-ke-karboksil, denganpenambahan secara berurutan asam

amino pada ujung karboksil dari rantai

peptida yang sedang tumbuh (lihatGambar berikut . 1/1/2014 8


9/29

1. Translasi Urutan Nukleotida Menjadi Urutan asam Amino

Pertumbuhan rantai polipeptida. Protein

disintesis dengan penambahan berurutan

asam amino pada terminal/ujung karboksil.

1/1/2014 9


10/29

1.1. The Synthesis of Long Proteins Requires a

Low Error Frequency

The process of transcription is analogousto copying, word for word, a page from abook.

There is no change of alphabet orvocabulary; so the likelihood of a changein meaning is small.

Translating the base sequence of anmRNA molecule into a sequence of aminoacids is similar to translating the page of a

book into another language. Translation is a complex process,

entailing many steps and dozens ofmolecules. The potential for error exists at

each step. 1/1/2014 10


11/29

1.2. Transfer RNA Molecules Have a

Common Design

The fidelity of protein synthesis requires theaccurate recognition of three-base codons onmessenger RNA.

Recall that the genetic code relates each amino

acid to a three-letter codon. An amino acid cannot itself recognize a codon.

Consequently, an amino acid is attached to aspecific tRNA molecule that can recognize thecodon by Watson-Crick base pairing.

Transfer RNA serves as the adapter moleculethat binds to a specific codon and brings with itan amino acid for incorporation into thepolypeptide chain.

1/1/2014 11


12/29

1.3. The Activated Amino Acid and the Anticodon of

tRNA Are at Opposite Ends of

the L-Shaped Molecule

The most important properties of the tRNA structure are:

1. The molecule is L-sh aped (Figur e 29.5).

2. There are two apparent ly co nt inuou s segments o f dou ble helix .These segments are l ike A-form DNA, as expected fo r an RNAhelix . The base-pairing predicted from the sequence analysis is

correct. The helix containing the 5 and 3 ends stacks on top of thehelix that ends in the TyC loop to form one arm of the L; theremaining two helices stack to form the other (Figure 29.6).

3. Most of the bases in the nonhelical regions participate inhydrogenbonding interactions, even if the interactions are notlike those in Watson-Crick base pairs.

4. The CCA terminus containing the amino acid attachment site

extends from o ne end o f the L. This sing le-stranded region canchange conformation during amino acid activation and proteinsynthesis.

5. The anticodon loop is at the other end of the L, makingaccessible the three bases that make up the anticodon.

1/1/2014 12


13/29

1.3. The Activated Amino Acid and the Anticodon of tRNA Are at Opposite

Ends of the L-Shaped Molecule

Figure 29.4. General Structure of tRNA Molecules. Comparison of the basesequences of many tRNAs reveals a number of conserved features.

29.5. L-Shaped tRNA Structure. A skeletal model of yeast phenylalanyl-tRNA revealsthe L-shaped structure. The CCA region is at the end of one arm, and the anticodon loopis at the end of the other.

Figure 29.6. Helix Stacking in tRNA. The four helices of the secondary structure oftRNA (see Figure 29.4) stack to form an L-shaped structure.

1/1/2014 13


14/29

2. Aminoacyl-Transfer RNA Synthetases

Read the Genetic Code

The linkage of an amino acid to a tRNA is crucial fortwo reasons. First, the attachment of a given amino acid to a particular

tRNA establishes the genetic code. When an amino acidhas been linked to a tRNA, it will be incorporated into agrowing polypeptide chain at a position dictated by theanticodon of the tRNA.

Second, the formation of a peptide bond between freeamino acids is not thermodynamically favorable. Theamino acid must first be activated for protein synthesis to

proceed. The activated intermediates in protein synthesis are

amino acid esters, in which the carboxyl group of anamino acid is linked to either the 2 - or the 3 -hydroxylgroup of the ribose unit at the 3 end of tRNA.

An amino acid ester of tRNA is called an aminoacyl-tRNAor sometimes a charged tRNA.1/1/2014 14


15/29

2.1. Amino Acids Are First

Activated by Adenylation

The activation reaction is catalyzed by specific

aminoacyl-tRNA synthetases, which are also called

activating enzymes.

The first step is the formation of an aminoacyladenylate from an amino acid and ATP.

This activated species is a mixed anhydride in which

the carboxyl group of the amino acid is linked to the

phosphoryl group of AMP; hence, it is also known as

aminoacyl-AMP.

1/1/2014 15


16/29

The next step is the transfer of theaminoacyl group of aminoacyl-AMP to a

particular tRNA molecule to form

aminoacyl-tRNA.

The sum of these activation and transfersteps is

1/1/2014 16


17/29

1/1/2014 17


18/29

1/1/2014 18


19/29

1/1/2014 19


20/29

1/1/2014 20


21/29

1/1/2014 21


22/29


23/29

Post Translation

Protein structure is determined byamino acid sequence and modifications

Modifications include

The attachment of certain sugars, lipids, orphosphate groups

Joining different subunits of the protein to

create the quaternary structure

1/1/2014 23


24/29

Point Mutations

The change of a single nucleotide in the

DNAs template strand

1/1/2014 24


25/29

Two Types of Mutation

Substitutions

Replacing one or more base with others

Insertions or DeletionsAdding or removing one or more base

1/1/2014 25


26/29

Gambaran umum proses ekspresi gen(dari transkripsi sampai translasi)

1/1/2014 26


27/29

Latihan soal

1. Urutan satu untai tunggal dari 53basanukleotida DNA open reading frame(ORF)

adalah sebagai berikut: 5- ATGGGCAA

ATTGCGCTTGGGGCCGCCGATGGTATTGC

CCAAATTTGCCCCGATGGTACCGGGGTAC

TTTTGGCCGCTCTAA-3

Tentukan urutan asam amino hasil translasi!

2. Jelaskan apa saja yang terlibat dalam prosesbiosintesis protein !


28/29

Terima kasih, selamat

belajar!!!

1/1/2014 28


29/29

21 Metabolisme Karbohidrat, Siklus AsamSitrat dan Fosforilasi Oksidatif.

Selasa,27Nop2012 8.30- 10.10 Pak Wira

22 SGD 2 Klp(Pembentukan Keton bodi ,Transport lipida) Rabu, 28 Nop2012 8.30- 10.10 Bu Ratna +Klp15 dan Klp

1623 Lanjutan Metabolisme Karbohidrat Selasa, 4 Des2012 8.30- 10.10 Pak Wira22. SGD 2 Klp(Pengaturan Metabolisme

Karbohidrat Secara Hormonal, Gangguan

Klinis Metabolisme Karbohidrat)Rabu, 5 Des2012 11.00-11.50 Pak Wira , Klp

17 dan Klp 18

23. Struktur Asam Nukleat Selasa, 11 Des2012 8.30- 10.10 Pak Wira24. SGD 2 Klp + SGD 2 Klp(Struktur tRNA) dan

Struktur &fungsi Ribosom), Rabu, 12 Des2012 11.00-11.50 Pak Wira, Klp

19 dan Klp 20

25. Replikasi DNA dan Biosintesa Protein Selasa, 18 Des 2012 8.30- 10.10 Pak Wira26. Lanjutan + SGD 1 Klp(Antibiotik Penghambat

Replikasi/Translasi) Rabu, 19 Des 2012 11.00-11.50 Pak Wira danKlp 2127 Resume Rabu, 26 Des 2012 11.00- 11.50 Pak Wira

1/1/2014 29

5. biosintesis protein biokim inw

Documents